Journal of Food and Nutrition Sciences
Volume 3, Issue 6, November 2015, Pages: 203-208

Identification of Lactic Acid Bacteria in Raw Milk and Kariesh Cheese with Special Reference to Lactococcus garvieae

Eman Nabil Abdelfatah*, Asmaa Badr Moustafa Badr Tahoun

Food Control Department, Faculty of Veterinary Medicine, Zagazig Univeristy, Zagazig, Egypt

Email address:

(E. N. Abdelfatah)

To cite this article:

Eman Nabil Abdelfatah, Asmaa Badr Moustafa Badr Tahoun. Identification of Lactic Acid Bacteria in Raw Milk and Kariesh Cheese with Special Reference to Lactococcus garvieae.Journal of Food and Nutrition Sciences.Vol. 3, No. 6, 2015, pp. 203-208. doi: 10.11648/j.jfns.20150306.11


Abstract: Lactic Acid Bacteria (LAB) are used widely in the manufacture of fermented foods and inhibiting pathogenic as well as spoilage bacteria in these products and they are considered to be highly useful microorganisms to society, so we carried out this work to identify lactic acid bacteria in raw milk and traditional Egyptian raw milk starter-free cheese (kariesh cheese). In our work total of 246 isolates were isolated from raw milk and kariesh cheese obtained from different markets in Sharkia Governorate, Egypt. After further identification, results cleared that Lactococcus lactis subsp. lactis and lactobacillus rhamnosus were the most prominent strains isolated from raw milk by19.85% for each, while lactobacillus rhamnosus was the most prominent strain in kariesh cheese by 34.55%. Lactococcus garvieae (L.garvieae) was detected in both raw milk and kariesh cheese by 3 (2.21%) and 1 (0.91%) for each respectively. The isolated strains were analyzed for the presence of some virulence genes by using PCR with specific primers and results cleared that Fibronectin-binding proteins (fbp) and haemolysin (hly) genes were present in two samples, while (hly) present in one sample and (fbp) present in one sample each alone. On the other hand the antimicrobial drug susceptibility pattern for the isolated L.garvieae strains showed high resistance against penicillin, methicillin, cefpodexime and cephalothin reach 100%, while they show high sensitivity to ampicillin and tetracycline reach 100%.

Keywords: Lactococcus garvieae, Kariesh Cheese, Lactic Acid Bacteria, Raw Milk


1. Introduction

Milk is considered as one of the gifts that are given to humans from god, as it is a very nutritious food; not only for the human beings but also for the new born mammal [1], as it contains nearly all nutrients like proteins, minerals, fats and vitamins [2]. It is worth mentioning that kariesh cheese is one of the most popular local type of fresh soft cheese for egyptian consumers, this is mainly due to its high protein content, it is relatively fat free and low price [3], so it is often recommended for persons requiring low fat diets as those suffering from heart diseases, obesity and cholesterol [4].

Raw milk and raw milk cheese are a complex microbial community, because of the high nutrients and high water content of these foods allow the growth of many microbes [5] including pathogens, spoiling bacteria and technological flora such as LAB [6]. This LAB originated from the milk and from the dairy environment which play the main role in the contamination of the milk or cheese curd during manufacture [7]. Also, they associated with meat, vegetables and they could be isolated from lakes, soil, intestinal tract of animals and humans [8]. These microorganisms can give desirable fermentative reactions [9] and so they widely used as starter cultures in the manufacture of many fermented products including mainly milk products and may be used in others like meat products, bakery products and wine [10]. LAB has been detected to have many potential health benefits in humans and animals [11].

LAB, including numerous genera such as lactobacillus, lactococcus, streptococcus, enterococcus and leuconostoc [12]. The genus lactococcus was considered as a part of the genus streptococcus at first then, it was established as a separate genus since1985 [13]. It includes seven species, L. garvieae, L. lactis, L. plantarum, L. piscium, L. chungangensis, L. fujiensis and L. raffinolactis [14]. The members of this genus were known as the lactic acid group of streptococci long ago and they have not any demonstrable role as pathogens in humans or animals [15] except L.garvieae, as it is the only species that is classified as pathogenic [16]. It is identified as the most important pathogen to fish aqua culture as it causes septicemia in fish, also it is considered as an emerging zoonotic pathogen [17]. The host range of L.garvieae is not limited to aquatic species, as it has been found in cows with mastitis and also some dairy products including goat cheeses and cow raw milk [18]. Nowadays L.garvieae importance increase in both human and veterinary medicine, but the available data on this pathogen in food is very little other than fish products till now [17]. So we carried out this work to identify lactic acid bacteria in raw milk and raw milk starter-free cheese (kariesh cheese), detect the incidence of pathogenic L.garvieae in both products and study the virulence of isolated L.garvieae strain.

2. Materials and Methods

2.1. Sampling Collection

A total of 30 samples (raw milk (n=20) and kariesh cheese (n=10) was collected from the local markets in Sharkia Governorate, Egypt and kept at 4C until arrival at the laboratory inside ice box. The samples were transferred immediately to the laboratory for microbiological analysis.

2.2. Isolation of Lactic Acid Bacteria

Eleven (11) ml.or gm. of each item (raw milk and kariesh cheese) was taken, aseptically and transferred to the separate sterile container, containing 99 ml of sterile saline solution. The latter was shaken well until a homogeneous dispersion of 1:10 dilution obtained, then serially diluted [19] and inoculated on plates, where Lactococci were grown on M17 agar (Scharlau) and enumerated after 48h of incubation at 32ºC [20]. Lactobacilli were grown on (MRSA; Merck), carried out anaerobically using the gas pack system at 30 ºC for 48h [21]. Colonies with distinct morphological differences as color, shape and size were selected and purified by streaking at least three times in M17 and MRS agar, then isolated. All isolates were initially examined for Gram reaction and production of catalase. Only Gram-positive and catalase negative isolates were considered and stored at-80 ºC in M17 and MRS broth with 20% glycerol. These frozen stocks were used for further identification (chemical and serological).

2.3. Confirmation of L. garvieae Using PCR and Detection of Virulence Gene

1. Primer sequences of L. garvieae used for PCR identification system:

Application of PCR for identification and characterization of gyrase B (gyrB), cell wall adhesion protein " fibronectin binding protein" (fbp) and hemolysin (hly) genes as virulence factors of L.garvieae was performed essentially by using Primers (Pharmacia Biotech) as shown in table(4).

2. DNA Extraction:

DNA was extracted according to [22] using the QIAamp kit, following the manufacturer’s instructions from over night incubated strain in pure culture that centrifuged (9600xgat4°Cfor10min). Nucleic acid was eluted with 100µl of elution buffer provided in the kit. From this suspension, a5µl aliquot was directly used as a template for PCR amplification.

3. DNA amplification reaction of L. garvieae[23]:

The amplification was performed on a Thermal Cycler (Mastercycler, Eppendorf, Hamburg, Germany). The multiplex PCR was set up in a master mix containing 7. 5μl of PCR mixture, 0.38µL water and 0.5µM of each primer, was combined with 7µL of each cDNA sample. The cycling conditions for the PCR procedure included an initial cycle of denaturation at 94°C for 5 min, followed by 40 cycles of denaturation 95°C for 30 sec, annealing and extension 60°C for 30 secand then a final extension at 60°C for 30 sec. The gyrB gene was used as internal control to which other virulence gene expression was normalized.

4. Gel electrophoresis of amplified products:

Amplified products were analyzed by 1.5% agarose gel electrophoresis stained with ethidium bromide and visualized and captured on UV transilluminator. A 100bp DNA ladder was used as a marker for PCR products.

2.4. Antimicrobial Susceptibility Test

Antimicrobial sensitivity of the isolates was performed according to the agar disc diffusion method on Mueller-Hinton agar [24,25]. The following antimicrobial discs were applied: penicillinG(10µg), Tetracycline(30µg), Ciprofloxacin(5µg), Ceftriaxone(30µg), methicillin(5µg), Cephalothin(30µg), cloxacillin(30µg), Ampicillin(10µg), Amoxyclav(30µg), Erythromycin(15µg), Rifampicin(30µg), Cefpodoxime(10µg), Carbenillicin(100µg),v ancomycin(30µg). The disks were dispensed on the surface of the medium and incubated aerobically at 32°C for 24 hours. Strains were evaluated as susceptible, intermediate or resistant by measurement of the inhibition of the zone diameter according to the interpretive standard of [25].

3. Results and Discussion

A Total of 246 cultures was isolated from raw milk and kariesh cheese, including 136 and 110 for each respectively. The first screening revealed the presence of 83 cocci(45 for raw milk and 38 for kariesh cheese) and 163 rods(91 for raw milk and 72 for kariesh cheese) which were subjected to chemical techniques for identification (Table1).

Table (1) cleared that Lactococcus lactis subsp. lactis and lactobacillus rhamnosus were the most prominent strains isolated from raw milk by 19.85% for each, while lactobacillus rhamnosus was the most prominent strain in kariesh cheese by 34.55%. Regarding other researches Corroler et al. [26], Gemelas et al. [27], Ouadghiri et al. [28] gave similar results as they reported that lactococcus lactis subsp. lactis was the most detected strains in raw milk, while Aziz et al. [29], Abdullah and Osman [11] found lactobacillous acidophilus and Lactobacillus xybosus as predominant strains respectively.

Table 1. Identification of lactic acid bacteria isolated from both raw milk and kariesh cheese.

Sample No.of isolates Isolates No. %
Raw milk 136 Lactococcuslactis subsp. Cremoris 15 11.03%
Lactococcuslactis subsp. Lactis 27 19.85%
Lactococcusgarvieae 3 2.21%
Lactobacillus rhamnosus 27 19.85%
Lactobacillus plantarum 18 13.24%
Lactobacillus fermentum 12 8.82%
Lactobacillus lactis 16 11.76%
Lactobacillus casei 15 11.03%
Lactobacillus pentosus 3 2.21%
         
Kariesh cheese 110 Lactococcuslactis subsp. Cremoris 18 16.36%
Lactococcuslactis subsp. Lactis 19 17.27%
Lactococcusgarvieae 1 0.91%
Lactobacillus fermentum 19 17.27%
Lactobacillus casei 15 13.64%
Lactobacillus rhamnosus 38 34.55%

On the other hand El-Baradei et al. [30], Garabal et al. [31] found lactococcus lactis subsp. lactis as the predominant strain in raw milk cheese, while lactobacillus brevis and lactobacillus casie were detected by Abdullah and Osman [11].

Also table (1) indicated the presence of L.garvieae in 3 (2.21%) of raw milk and 1 (0.91%) of kariesh cheese. On the contrary, El-Baradei et al. [30] detected L.garvieae in 100% of examined raw milk cheese, while Ouadghiri et al. [28] and Alrabadi [32] detected L. garvieae in only 6 and 10 samples of the examined raw milk samples respectively.

Recently, the gyrB gene was suggested as a suitable new marker for bacterial identification [33,34] "Huang [35] reported that gyrB is a single copy gene, present in all bacteria, which encodes the ATPase domain of DNA gyrase, an enzyme essential for DNA replication". "The amino acid sequences of GyrB are conservative enough to allow the comparison of taxa which are not closely related [33,35]". So we use this gene for bacterial molecular identification and confirmation of conventional method results. It was detected that this gene present in the four isolates which were identified as L. garvieae by these conventional methods.

L. garvieae was classified according to the presence of a capsule plays an important role in pathogenicity into two serotype.This capsule may have a role in the ability to produce intra and extracellular toxins [16]. This may explain why Barnes et al. [36] found that capsulated strains (KG-) were more virulent than non-capsulated(KG+), so we applied serological examination for the isolated four strains for detection of presence of the capsule and expectation of their pathogenicity. The results of serological tests showed that both capsulated and non capsulated strains were present and cleared that the capsulated strain was present in both raw milk and kariesh cheese by 33.3% and 100% respectively (Table2).

Table 2. Serodiagnosis of detected L. garvieae in both raw milk and kariesh cheese.

Sample Identified Bacterium Slide Agglutination test
Raw milk L. garvieae Capsulated KG- L. garvieae
Raw milk L. garvieae Non Capsulated KG+ L. garvieae
Raw milk L. garvieae Non Capsulated KG+ L. garvieae
Kariesh cheese L. garvieae Capsulated KG- L. garvieae

Several studies detected that the presence of capsule on the cell surface of L. garvieae is one of the virulence factors for fish, although the pathogenic mechanisms are poorly understood [36,37]. As Kang et al. [38] demonstrated that Capsulated L.garvieae strain is more virulent in fish than non capsulated one. On the contrary strains isolated from human suffering from endocarditis, show pathogenicity in human, even if they did not carry a capsule gene, so it was indicated that the presence of a capsule gene cluster is not the only factor leads pathogenicity, as L. garvieae genome carries other potential virulence factors such as adhesion surface proteins, haemolysins and others [23]. So PCR experiments carried out with primers designated on cell wall adhesion protein fibronectin binding protein(fbp) and hemolysin (hly) conserved sequences, as these virulance genes could be considered as part of the core genome of the L.garvieae species [23].

Fibronectin-binding proteins (Fbps) were defined as surface receptors of the extracellular matrix (ECM) mainly present on Gram-positive cocci surface [39]. Facilitate the attachment of pathogenic micro-organisms to the host cells [40]. It has been suggested that it has an essential role in the development of endocarditis [41]. Also, it is worth to be mentioned that hemolysin (Hly) is a protein that has a great ability to lyse erythrocytes [42]. Most hemolysins are protein compounds, but others are lipids [43]. Some (Hly) lysis erythrocytes by the formation of pores in the phospholipid bilayers of erythrocyte membranes, while others act by hydrolyzing this phospholipids in the bilayer [44] so, Hly was seemed to be toxic to a wide variety of mammalian erythrocytes over a wide range of concentrations [45].

Regarding detection of virulence factors, the isolated strains were analyzed for the presence of the virulence determinants by using PCR with specific primers given in table(4). Results in figure(1): cleared that (fbp) and (hly) genes were present in two samples which were identified by serological tests as capsulated strains, while (hly) present in one sample and (fbp) present in one sample each alone in the strains which have not a capsule. On the contrary Fortina et al. [46] discovered that L.garvieae strains of dairy origin were free from 47 virulence determinants and Foschino et al. [47] suggested that L.garvieae dairy strains are unrelated to the pathogenic ones. Inaddition, clinical cases associated with L.garvieae infection have been reported in humans [48] although in humans, it is a rare pathogen and of low virulence [49]. The signs and symptoms of infection ranges from the urinary tract, blood, skin and pneumonic processes. While other patients have been found with bacterial endocarditis and is believed to be occurred in patients with immunosuppression or liver cirrhosis [50].

Figure 1. Agarose gel electrophoresis of multiplex PCR for gyrB (150 bp), fbp (181 bp) and hly (301 bp) virulent genes for demonstration and characterization of L. garvieae. Lane M: 100 bp ladder as molecular size DNA marker-Lane 1: Control positive for gyrB, fbp and hly genes. Lane 2: Control negative.-Lane 3 & 6: Positive L. garvieae strains for gyrB, fbp and hly genes.-Lane 4: Positive L. garvieae strains for gyrB and fbp genes.-Lane 5: Positive L. garvieae strains for gyrB and hly genes. N.B. (3-4-5 strains isolated from raw milk samples and 6 strain of kariesh cheese).

Table 3. Antimicrobial sensitivity pattern of isolated L. garvieae strains.

Type of antimicrobial No. of L. garvieae isolates (n=4)
Sensitive(%) Moderate(%) Resistance(%)
penicillin G - - 4(100%)
Tetracycline 4 (100%) - -
Ciprofloxacin 2(50%) 2(50%) -
Ceftriaxone - 2(50%) 2(50%)
Methicillin - - 4(100%)
Cephalothin - - 4(100%)
Cloxacillin 3(75%) 1(25%) -
Ampicillin 4(100%) - -
Amoxyclav 1(25%) 2(50%) 1(25%)
Erythromycin - 2(50%) 2(50%)
Rifampicin 3(75%) 1(25%) -
Cefpodoxime - - 4 (100%)
Carbenillicin - 3(75%) 1(25%)
Vancomycin 1(25%) 1(25%) 2(50%)

On the other hand the antimicrobial drug susceptibility pattern for the 4 isolated microorganisms from milk and kariesh cheese is shown in Table (3). In this study % of L.garvieae isolates showed high resistance against penicillin, methicillin, cefpodexime and cephalothin reach 100%, followed by erythromycin and ceftriaxone showed 50%, while they show high sensitive to ampicillin and tetracycline reach 100%, followed by coxacillin and rifampicin 75%, then ciprofloxacin 50% and finally amoxyclav and vancomycin 25%.

These results were agreed with those of Tanrikul and Gultepe [51] as he cleared that L.garvieae was sensitive to ampicillin. On the contrary Baeck et al. [52] found that it was highly sensitive to nitrofurantoin.

Alrabadi [32] detected that Trimethoprim was having best antimicrobial activity against L. garvieae. On the other hand, he recommended not using Clindamycin, PolymyxinB, Erythromycin, Ampicillin and Tetracycline, because they showed slight or no effect at all against L.garvieae.

Kaliwal and Suneel [53] showed that L.garvieae was resistant to cefpodexime, penicillin, methicillin and cephalothin, while it was susceptible to carbenicillin, tetracycline, rifampicillin, ciprofloxacin, amikacin, cloxacillin and norfloxacin.

Table 4. Oligonucleotide primers sequences used for PCR amplification of identification and virulance genes of Lactococcusgarvieae.

Target gene Oligonucleotide sequence (5′ → 3′) Product size (bp) Reference
gyrB (F) 5′ TAGCACTTGTTTGGCTTTGTGC ′3 150 Ferrario (2012)
gyrB (R) 5′ CCATAGATGGAGAACCACATCA ′3
fbp (F) 5′ CGGTTCGTTCAGGAAGAACATC ′3 181
fbp (R) 5′ CGGTCATTGCCTACTTGCTCAA ′3
hly (F) 5′ TGGTAAACTTGCGGACTGCTCT ′3 301
hly (R) 5′ TCCACGTTCAAGATTTTACCACG ′3

4. Conclusion

The results obtained in this study revealed the presence of a variety of LAB in the raw milk and traditional Egyptian starter-free kariesh cheese and indicated that pathogenic L. garvieae could be isolated from both products and these isolates carry one or more virulance genes. On the other hand, we investigated the effect of several antibiotics on isolated L.garvieae where our findings indicated that they showed high resistance against penicillin, methicillin, cefpodexime and cephalothin reach100%, while they show high sensitive to ampicillin and tetracycline reach 100%.

References

  1. LeJeune JT, Rajala-Schultz PJ. Food safety: Unpasteurized milk: a continued public health threat. Clinical Infectious Diseases. 48, 2009, P. 93-100. DOI: 10.1086/59 5007.
  2. Momtaz H, Dehkordi FS, Taktaz T, Rezvaniand A, Yarali S. Shiga Toxin-Producing Escherichia coli isolated from Bovine Mastitic Milk: Serogroups, Virulence Factors, and Antibiotic Resistance Properties. The Scientific World Journal. 2012, 2012, p. 1-10.
  3. Aldo T, Fady AA, Ola AHO. History, Processing and Quality Enhancement of Traditional Egyptian Kariesh Cheese: A Review. Food Science and Technology. 1, 2013, p. 1-6. DOI: 10.13189/fst.2013.010101.
  4. Fayed AE, Farahat AM, Metwally AE, Massoud MS, Emam AQ. Health stimulating properties of the most popular soft cheese in Egypt Kariesh made using skimmed milk UF-retentate and probiotics. Acta Scientiarum Polonorum Technol-ogia Alimentaria. 13, 2014, p. 359-373.
  5. Frank JF. Milk and dairy products.In: Doyle, P. - Beuchat, R. - Montville, J.. (Eds.) Food Microbiology Fundamental and Frontiers. ASM Press, Herndon, Virginia, USA, 1997.
  6. Franciosi E, Settanni L, Cavazza A, Poznanski E. "Biodiversity and technological potential of wild lactic acid bacteria from raw cows’ milk," International Dairy Journal. 19, 2009, p. 3–11. DOI: 10.1016/j. idairyj.2008.07. 008.
  7. Beresford TP, Fitzsimons NA, Brennan NL, Cogan TM. Recent advances in cheese microbiology. International dairy journal. 11, 2001, p. 259–274. DOI: 10.1016/ S0958-6946(01)00056-5.
  8. Chen YS, Yangida F, Shinahara T. Isolation and identification of lactic acid bacteria, from soil using enrichment procedure. Letters in Applied Microbiology. 40, 2005, p.195-200. DOI: 10.1111/j.1472-765X.2005.01653.x.
  9. Fox PF. In: Fox PF. (Ed.), Cheese: Chemistry, Physics and Microbiology, USA, Aspen Publications, Gaithersbury, MD., 2, 1999.
  10. Axelsson L. Lactic Acid Bacteria: Classification and physiology. In: Lactic Acid Bacteria, Microbiological and Functional Aspects. Salminen, A.V. - Wright, A.O. (Eds.) ouwehand. Marcel Dekker, New York, 2004, pp: 1-66.
  11. Abdullah SA, Osman MM. Isolation and Identification of Lactic Acid Bacteria from Raw Cow Milk, White Cheese and Rob in Sudan Pakistan Journal of Nutrition. 9, 2010, p. 1203-1206.
  12. Poznanski E, Cavazza A, Cappa F, Cocconcelli PS. Indigenous raw milk microbiota influences the bacterial development in traditional cheese from an alpine natural park. International Journal of Food Microbiology. 92, 2004, p. 141–151. DOI 10.1016/ j.ijfoodmicro.2003.09.006.
  13. Schleifer KH, Klaus J, Dvorak C, Kilpper-Balz R, Collins MD, Merquior W, Brenner DJ. Correlation between phenotypic characteristics and DNA relatedness within Enterococcus fueciumstrains. Journal of Clinical Microbiology. 33, 1995, p. 1520-1523.
  14. Cai Y, Yang J, Pang H, Kitahara M. Lactococcus fujiensis sp.Nov, a lactic acid bacterium isolated from vegetable matter. International Journal of Systematic and Evolutionary microbiology.61,2011,p.15901594.DOI:10.1099/ijs.0.025130-0.
  15. Ruoff K L. Leuconostoc, Pediococcus, Stomatococcus, and miscellaneous gram-positive cocci that grow aerobically, In Murray P R, Baron E J, Pfaller MA, Tenover FC, Yolken RH (ed.), Manual of clinical microbiology, 6th ed. American Society for Microbiology, Washington, D.C., 1995, p. 315-323.
  16. Vendrell D, Balca´zar JL, Ruiz-Zarzuela I, De Blas I, Girones O, Muzquiz JL. Lactococcus garvieae in fish: a review. Comparative Immunology, Microbiology and Infectious diseases. 29, 2006, p.177–198.
  17. Ferrario C, Ricci G, Borgo F, Rollando A, Fortina MG. Genetic investigation within Lactococcus garvieae revealed two genomic lineages. Federation of European Microbiological Societies (FEMS) Microbiol Letters. 332, 2012, p. 153–161.
  18. Ferna´ndez E, Alegrı´a A, Delgado S, Mayo B. Phenotypic, genetic and technological characterization of Lactococcus garvieae strains isolated from a raw milk cheese. International dairy journal. 20, 2010, p. 142–148. DOI: 10.1016/j. idairyj.2009. 11.004.
  19. American Public Health Association "A.P.H.A.": Compendium of Methods for the Microbiological Examination of Foods.3rd Ed.(Vanderzant, C and Splittoesser, D. Eds) Washington DC, USA, 2003.
  20. Terzaghi BE, Sandine WE. Improved medium for lactic streptococci and their bacteriophages. Applied Microbiology. 29, 1975, p. 807–813.
  21. De Man JC, Rogosa M, Sharpe ME. A medium for the cultivation of lactobacilli. Journal of Applied Bacteriology. 23, 1960, p. 130–135. DOI: 10.1111/j.1365-2672.1960.tb00188.x.
  22. Miyauchi E, Toh H, Nakano A, Tanabe S, Morita H. Comparative genomic analysis of Lactococcus garvieae strains isolated from different sources reveals candidate virulence genes. International Journal of Microbiology. 2012, 2012, p. 1-7.DOI. org/10.1155/20 12/728276.
  23. Ferrario C. Lactococcus garvieae and Morganella morganii: two bacterial models to study quality and safety of fish products. Ph.DThesis, Dept. Food, Environmental and Nutritional Sciences, Fac. Science, Milano Univ., Milano, Italy, 2012.. Downloaded from https://air.unimi.it/retrieve/ handle/2434/215691/ 262425/PhD_ unimi_R08810.pdf
  24. NCCLS (National Committee for Clinical Laboratory Standards). Performance standards for antimicrobial disk and dilution susceptibility tests for bacteria isolated from animals. Approved Standard, (NCCLS document M31- A2, Wayne, PA), 28, 2002, ISBN-1-56238-659-X.
  25. CLSI (Clinical and Laboratory Standards Institute). Performance standards for antimicrobial disc and dilution susceptibility tests for bacteria isolated from animals; approved standards (FOURTH Ed.) Document VETO1-A4, 28, 2013, ISBN-1-56238-878-9.
  26. Corroler D, Mangin I, Desmasures N, Gueguen M. An Ecological Study of Lactococci Isolated from Raw Milk in the Camembert Cheese Registered Designation of Origin Area. Applied and environmental microbiology. 64, 1998, p. 4729–4735.
  27. Gemelas L, Rigobello V, Ly-Chatain MH, Demarigny Y. Selective Lacto-coccus Enumeration in Raw Milk. Food and Nutrition Sciences. 4, 2013, P. 49-58. DOI. org/10.4236/fns. 2013.49A2008.
  28. Ouadghiri M, Vancanneyt M, Vandamme P, Naser S, Gevers D, Lefebvre K, et al. Identification of lactic acid bacteria in Moroccan raw milk and traditionally fermented skimmed milk ‘lben’. Journal of Applied Microbiology. 106, 2009, p. 486–495. DOI:10.1111/j.1365-2672.2008.0 4016.x.
  29. Aziz T, Khan H, Bakhtair SM, Naurin M. Incidence and relative bundance of lactic acid bacteria in raw milk of buffalo, cow and sheep. The Journal of Animal & Plant Sciences. 19, 2009, p. 168-173.
  30. El-Baradei G, Delacroix-Buchet A, Ogier J. Biodiversity of Bacterial Ecosystems in Traditional Egyptian Domiati Cheese. Applied and environmental microbiology. 73, 2007, p. 1248–1255. DOI: 10.1128/AEM.01667-06.
  31. Garabal JI, Rodriguez-Alonso P, Genteno JA. characterization of lactic acid bacteria isolated from raw cow's milk cheeses currently produced in Galicia (NW Spain) LWT-Food Science and technology. 41, 2008, P. 1452-1458. DOI:10. 1016/j.lwt.2007. 09.004
  32. Alrabadi NI. The effect of several antibiotic on Lactococcus garvieae isolated from Jordanian dairy products. American Journal of Agricultural and Biological Sciences. 7, 2012, p. 468-472. DOI: 10.3844/ajabssp.2012.468.472
  33. Yamamoto S, Harayama S. Phylogenetic analysis of Acinetobacter strains based on the nucleotide sequence of gyrB genes and on the amino acid sequences of their products. International journal of systematic bacteriology. 46, 1996, P. 506–511.
  34. Yamamoto S, Bouvet PJM, Harayama S. Phylogenetic structures of the genus Acinetobacter based on the gyrB sequences: comparison with the grouping by DNA–DNA hybridization. International journal of systematic bacteriology. 49, 1999, P. 87–95.
  35. Huang WM. Bacterial diversity based on type II DNA topoisomerase genes. Annual Review of Genetics. 30, 1996, P. 79–107.
  36. Barnes AC, Guyot C, Hansen BG, Mackenzie K, Horne MT, Ellis AE. Resistance to serum killing may contribute to differences in the abilities of capsulated and non-capsulated isolates of Lactococcus garvieae to cause disease in rainbow trout (Oncorhynchus mykiss L.). Fish and Shellfish Immunology. 12, 2002, p. 155–168. DOI: 10.1006/fsim.2001.0361
  37. Aquilanti L, Garofalo C, Osimani A, Silvestri G, Vignaroli C, Clementi F. "Isolation and molecular characterization of antibiotic-resistant lactic acid bacteria from poultry and swine meat products," Journal of Food Protection. 70, 2007, p. 557–565.
  38. Kang SH, Shin GW, Shin YS. "Experimental evaluation of pathogenicity of Lactococcus garvieae in black rock- fish (Sebastes schlegeli)," Journal of Veterinary Science. 5, 2004, P. 387–390.
  39. Navarre WW, Schneewind O. Surface proteins of gram positive bacteria and mechanisms of their targeting to the cell wall envelope. Microbiology and molecular biology reviews. 63, 1999, p. 174–229.
  40. Van der Flier M, Chhun N, Wizemann TM, Min J, McCarthy JB, TuomanenI E. Adherence of Streptococcus pneumoniae to immobilized fibronectin. Infection and Immunity. 63, 1995, p. 4317–4322.
  41. Scheld WM. Pathogenesis and pathophysiology of infective endocarditis. In Sande MA, Kaye D, Root RK. (ed.), Endocarditis. Churchill Livingstone, Ltd., New York, N.Y., 1984, p. 1–32.
  42. Mackman N, Holland IB. Functional characterization of a cloned haemolysin determinant from E. coli of human origin, encoding information for the secretion of a 107L polypeptide. Molecular and General Genetics. 320, 1984, p. 123–134.
  43. Stipcevic T, Piljac T, Isseroff RR. "Di-rhamnolipid from Pseudomonas aeruginosa displays differential effects on human keratinocyte and fibroblast cultures". Journal of Dermatological Science. 40, 2005, p. 141–3. DOI: 10.1016 /j.jdermsci.2005. 08.005
  44.  Chalmeau J,  Monina N, Shin J, Vieu C, Noireaux V. α-Hemolysin pore formation into a supported phospholipid bilayer using cell-free expression.Biochimica et Biophysica Acta (BBA). 1808, 2011, p. 271–278. DOI: 10.1016/j. bbamem. 2010.07.027
  45. Suttrop N, Floer B, Schnittler H, Seeger W, Bhakdi S. Effects of Escherichia coli hemolysin on endothelial cell function. Infection and Immunity. 58, 1990, p. 3796–3801.
  46. Fortina MG, Ricci G, Foschino R, Picozzi C, Dolci P, Zeppa G. et al. Phenotypic typing, technological properties and safety aspects of Lactococcus garvieae strains from dairy environments. Journal of Applied Microbiology. 103, 2007, P. 445-453. DOI: 10.1111/j.1365-2672.2006.03265.x
  47. Foschino R, Nucera D, Volponi G, Picozzi C, Ortoffi M, Bottero MT. Comparison of Lactococcus garvieae strains isolated in northern Italy from dairy products and fishes through molecular typing. Journal of Applied Microbiology. 105, 2008, P. 652-662. DOI: 10.1111/j.1365-2672.2008.03780.x
  48. Li WK, Chen YS, Wann SR, Liu YC, Tsai HC. Lactococcus garvieae endocarditis with initial presentation of acute cerebral infarction in a healthy immunocompetent man. Internal Medicine journal. 47, 2008, P. 1143–1146.
  49. Wilbring M, Alexiou K, Reichenspurner H, Matschke K, Tugtekin SM. 2011.Lactococcus garvieae causing zoonotic prosthetic valve endocarditis.Clinical Research in Cardiology. 100, 2011, p. 545-546.
  50. Zuily S, Mami Z, Meune C.Lactococcus garvieaeendocarditis.Archives of Cardiovascular Diseases. 104, 2011, p. 138–139. DOI:10.1016/j.acvd.2010. 05.005
  51. Tanrikul T, Gultepe N. Mix Infection in Rainboe Trout (Oncorhynuchus mykiss Walbaum): Lactococcus garvieae and Vibrio anguillarum O1. Journal of Animal and Veterinary Advances. 10, 2011, p. 1019-1023. DOI: 10.3923/javaa. 2011.10 19.1023.
  52. Baeck WG, Kim HJ, Gomez KD, Park CS. Isolation and characterization of Streptococcus sp. from diseased flounder (Paralichthys olivaceus) in Jeju Island. Journal of Veterinary Science. 7, 2006, p. 53-58. PMID: 16434850. DOI: org/ 10.4142/jvs.2006.7.1.53.
  53. Kaliwal B, Suneel D. Identification and characterization of Lactococcus garvieae and antimicrobial activity of its bacteriocin isolated from cow's milk. Asian journal of pharmaceutical and clinical research. 6, 2013, P.104-108.

Article Tools
  Abstract
  PDF(529K)
Follow on us
ADDRESS
Science Publishing Group
548 FASHION AVENUE
NEW YORK, NY 10018
U.S.A.
Tel: (001)347-688-8931